Top image

CloningCloning Methods

Ligation independent cloning (LIC)

We would like to inform you about our new vectors for Sequence and Ligation Independent Cloning (SLIC), an advanced version of the Ligation Independent Cloning method (LIC).

Introduction

LIC is a cloning method that makes use of annealing of single-stranded complementary overhangs on the target vector and a PCR-generated insert of at least 12 bases. The commercial InfusionTM system (Clontech) is based on the same principle and requires a 15-base overlap region. Single-stranded overhangs can be generated by using T4 DNA polymerase and only one dNTP in the reaction mix, leading to an equilibrium of 3'->5'-exonuclease and 5'->3'-polymerase activity at the site of the first occurrence of this nucleotide.

By optimising the reaction conditions, Li & Elledge (Nature Methods, 2007, 4 (3), 251-256) could show that no special requirements are needed for this overlap region (e.g. absence of one of the nucleotides in the terminal region). The incubation is done with T4 DNA pol. for 30 min. and stopped by adding dCTP to the reaction mix. After annealing of vector and insert, the mixture is used to transform E. coli.

Available vectors

We have obtained modified versions of our EMBL pETM-vectors from Dr. Sabine Suppmann (Core Facility of the MPI of Biochemistry, Martinsried) with following features:

  • Linear vector fragment is generated by PCR with single primer pair (no background colonies with original vector due to selection with lethal ccdB gene)
  • Universal annealing sites (3C-protease sequence at 5’-end, common 3‘-homology region in ccdB gene) added to gene specific primers (one insert for all vectors)

You can find a detailed description of these vectors and the protocol in the following publication:

Scholz et al. (2013), BMC Biotechnology, 13:12
http://www.biomedcentral.com/1472-6750/13/12

Available vectors are summarized in the following table. The vectors are available in our facility for internal users. External users can get the vectors from Addgene.

pCoofy

parental vector

N-tag

C-tag

Host

pCoofy1

pETM14

His6

none

E. coli

pCoofy18

pCoofy1

His10

none

E. coli

pCoofy7

pETM14

S-tag

none

E. coli

pCoofy12

pCoofy1

OneStrep

none

E. coli

pCoofy34

pCoofy12

S-OneStrep

none

E. coli

pCoofy21

pCoofy12

His10-OneStrep

none

E. coli

pCoofy19

pCoofy1

CBP

none

E. coli

pCoofy2

pETM22

Trx-His6

none

E. coli

pCoofy38

pCoofy2

Trx-His10

none

E. coli

pCoofy3

pETM33

His6-GST

none

E. coli

pCoofy8

pETM14

Halo

none

E. coli

pCoofy35

pCoofy4

MBP

none

E. coli

pCoofy4

pETM44

His6-MBP

none

E. coli

pCoofy15

pETM14

NusA

none

E. coli

pCoofy16

pCoofy15

His10-NusA

none

E. coli

pCoofy5

pET28M-Sumo1

His6-Sumo1

none

E. coli

pCoofy6

pET28M-Sumo3

His6-Sumo3

none

E. coli

pCoofy17

pCoofy6

His10-Sumo3

none

E. coli

pCoofy22

pCoofy7

S-tag

His10

E. coli

pCoofy31

pCoofy12

OneStrep

His10

E. coli

pCoofy36

pCoofy34

S-OneStrep

His10

E. coli

pCoofy24

pCoofy19

CBP

His10

E. coli

pCoofy23

pCoofy14

Trx

His10

E. coli

pCoofy25

pCoofy8

Halo

His10

E. coli

pCoofy37

pCoofy35

MBP

His10

E. coli

pCoofy26

pCoofy15

NusA

His10

E. coli

pCoofy32

pCoofy1

His6

OneStrep

E. coli

pCoofy33

pCoofy18

His10

OneStrep

E. coli

pCoofy11

pIEX1

His10

none

Insect (transient)

pCoofy27

pFastBac

His6

none

Insect

pCoofy28

pFastBac

His6-GST

none

Insect

pCoofy29

pFastBac

His6-MBP

none

Insect

We tested the cloning of inserts up to 3.3 kb and saw a clear correlation of decreasing number of colonies with increasing size of the vector and insert. So far, all control plates without insert were empty, so the ccdB selection is very efficient. As recommended by Li & Elledge, one should use the E. coli strain BW23474 for transformation. Although they used chemically competent cells, we suggest using electro-competent cells to have a higher transformation efficiency resulting in higher colony numbers.

Additional vectors can be constructed easily by modifying your favorite vector, e.g. vectors for transient expression in mammalian cells, C-terminal tags, secretion signals, etc.

Please feel free to contact us in case of questions or comments: pepcore@embl.de

Primer design

For the amplification of the linearised vector fragment you need the following universal primers (except for the SUMO vectors):

LP1rev GGGCCCCTGGAACAGAACTT
LP2for CGCCATTAACCTGATGTTCTGGGG

Because of the specific protease for the SUMO proteins, you need a different reverse primer for the pETSUMO(1 or 3)ccdB vectors (the forward primer LP2for is identical)

LP1sumo: TCCACCGGTTTGTTCCTGG
LP2for: CGCCATTAACCTGATGTTCTGGGG

Primer design for cloning your gene of interest into SLIC vectors is shown for GST as the gene of interest:

Add the 5’ homologous bases to your gene specific forward primer (3C protease site).

For the SUMO1/SUMO3 fusion vectors, the 5’ primer will look like this:

Add the 3’ homologous bases (ccdB) to your gene specific reverse primer.

In case you want to keep the option for restriction enzyme cloning, you can add restriction sites here for Hind III, Not I orXho I which are present in all of the available vectors.

Protocol for SLIC reaction

1. PCR
Amplify the vector(s) and your gene of interest with the LP1/LP2 primers and gene specific SLIC primers (designed as described above), respectively. Use a high fidelity polymerase like Pfu, Phusion, etc. in order to avoid mutations. The PCR products are purified by PCR purification columns. Quantify the inserts.

2. T4 DNA polymerase treatment
Take 1 µg of the vector and 1 µg of the inserts treat separately with 0.5 U of T4 DNA polymerase in T4 buffer (NEB) plus BSA in a 20 μl reaction at room temperature for 30 minutes. Stop the reaction by adding 1/10 volume of 10 mM dCTP and leave on ice.

Both the gel-purified vector and insert must be treated separately with T4 DNA polymerase.

15.6 µl vector or insert  
4 µl    5x buffer  
0.2 µl T4 DNA polymerase (5U/µl) RT incubation for 30 min
0.2 µl 10mg/ml BSA  
20 µl final vol.  

Stop the reaction with 2 µl 10 mM dCTP and place on ice.

3. Annealing
Set up a 10 µl annealing reaction using 1:1 insert to vector ratio with 100-150 ng of a the vector, 1x ligation buffer (NEB), appropriate amount of insert (molar ratio insert/vector between 1/1 and 2/1) and water. Incubate at 37°C for 30 minutes. Leave on ice or store in -20°C.

Note: We saw a clear correlation of the size of the fragments and the number of colonies after transformation (fewer colonies with increasing size), so the amount of insert has to be adjusted according to its size in order to have similar molar ratios.

Annealing reaction (different ratios of insert to vector can be tested)

3 µl insert  
3 µl vector  
1 µl 10X ligation buffer 37°C incubation for 30 min
3 µl H2O  
10 µl final vol.  

4. Transformation
3 µl annealing reaction is added to 50 µl electro-competent BW23474 cells, electroporated, then 300 µl SOC added, shaken at 37°C for 30-45 min and then everything plated.

Material you can get from our facility (EMBL internal users only)

  • Vectors for PCR or linearised vector DNA ready for T4 DNA polymerase treatment
  • T4 DNA polymerase + buffer
  • Primers LP1, LP2, LPsumo
  • Pfu DNA polymerase
  • E. coli BW23474 cells
  • His-3C protease
  • His-SenP2 (SUMO protease)

References

Li M.Z. & Elledge S.J. (2007), “Harnessing homologous recombination in vitro to generate recombinant DNA via SLIC”, Nature Methods, 2007, 4 (3), 251-256
Doyle S.A. (2005), “High-throughput cloning for proteomics research”, Methods Mol. Biol., 310, 107-113