CloningCloning Methods
Ligation independent cloning (LIC)
We would like to inform you about our new vectors for Sequence and Ligation Independent Cloning (SLIC), an advanced version of the Ligation Independent Cloning method (LIC).
Introduction
LIC is a cloning method that makes use of annealing of single-stranded complementary overhangs on the target vector and a PCR-generated insert of at least 12 bases. The commercial InfusionTM system (Clontech) is based on the same principle and requires a 15-base overlap region. Single-stranded overhangs can be generated by using T4 DNA polymerase and only one dNTP in the reaction mix, leading to an equilibrium of 3'->5'-exonuclease and 5'->3'-polymerase activity at the site of the first occurrence of this nucleotide.

By optimising the reaction conditions, Li & Elledge (Nature Methods, 2007, 4 (3), 251-256) could show that no special requirements are needed for this overlap region (e.g. absence of one of the nucleotides in the terminal region). The incubation is done with T4 DNA pol. for 30 min. and stopped by adding dCTP to the reaction mix. After annealing of vector and insert, the mixture is used to transform E. coli.
Available vectors
We have obtained modified versions of our EMBL pETM-vectors from Dr. Sabine Suppmann (Core Facility of the MPI of Biochemistry, Martinsried) with following features:
- Linear vector fragment is generated by PCR with single primer pair (no background colonies with original vector due to selection with lethal ccdB gene)
- Universal annealing sites (3C-protease sequence at 5’-end, common 3‘-homology region in ccdB gene) added to gene specific primers (one insert for all vectors)

The following vectors are currently available:
| E.coli: | Insect cells |
|
Sf9 (transient expression):
|
|
Baculovirus expression:
|
We tested the cloning of inserts up to 3.3 kb and saw a clear correlation of decreasing number of colonies with increasing size of the vector and insert. So far, all control plates without insert were empty, so the ccdB selection is very efficient. As recommended by Li & Elledge, one should use the E. coli strain BW23474 for transformation. Although they used chemically competent cells, we suggest using electro-competent cells to have a higher transformation efficiency resulting in higher colony numbers.
Additional vectors can be constructed easily by modifying your favorite vector, e.g. vectors for transient expression in mammalian cells, C-terminal tags, secretion signals, etc.
Please feel free to contact us in case of questions or comments: pepcore@embl.de
Primer design
For the amplification of the linearised vector fragment you need the following universal primers (except for the SUMO vectors):
| LP1rev | GGGCCCCTGGAACAGAACTT |
| LP2for | CGCCATTAACCTGATGTTCTGGGG |
Because of the specific protease for the SUMO proteins, you need a different reverse primer for the pETSUMO(1 or 3)ccdB vectors (the forward primer LP2for is identical)
| LP1sumo: | TCCACCGGTTTGTTCCTGG |
| LP2for: | CGCCATTAACCTGATGTTCTGGGG |
Primer design for cloning your gene of interest into SLIC vectors is shown for GST as the gene of interest:

Add the 5’ homologous bases to your gene specific forward primer (3C protease site).

For the SUMO1/SUMO3 fusion vectors, the 5’ primer will look like this:

Add the 3’ homologous bases (ccdB) to your gene specific reverse primer.

In case you want to keep the option for restriction enzyme cloning, you can add restriction sites here for Hind III, Not I orXho I which are present in all of the available vectors.
Protocol for SLIC reaction
1. PCR
Amplify the vector(s) and your gene of interest with the LP1/LP2 primers and gene specific SLIC primers (designed as described above), respectively. Use a high fidelity polymerase like Pfu, Phusion, etc. in order to avoid mutations. The PCR products are purified by PCR purification columns. Quantify the inserts.
2. T4 DNA polymerase treatment
Take 1 µg of the vector and 1 µg of the inserts treat separately with 0.5 U of T4 DNA polymerase in T4 buffer (NEB) plus BSA in a 20 μl reaction at room temperature for 30 minutes. Stop the reaction by adding 1/10 volume of 10 mM dCTP and leave on ice.
Both the gel-purified vector and insert must be treated separately with T4 DNA polymerase.
| 15.6 µl | vector or insert | |
| 4 µl | 5x buffer | |
| 0.2 µl | T4 DNA polymerase (5U/µl) | RT incubation for 30 min |
| 0.2 µl | 10mg/ml BSA | |
| 20 µl | final vol. |
Stop the reaction with 2 µl 10 mM dCTP and place on ice.
3. Annealing
Set up a 10 µl annealing reaction using 1:1 insert to vector ratio with 100-150 ng of a the vector, 1x ligation buffer (NEB), appropriate amount of insert (molar ratio insert/vector between 1/1 and 2/1) and water. Incubate at 37°C for 30 minutes. Leave on ice or store in -20°C.
Note: We saw a clear correlation of the size of the fragments and the number of colonies after transformation (fewer colonies with increasing size), so the amount of insert has to be adjusted according to its size in order to have similar molar ratios.
Annealing reaction (different ratios of insert to vector can be tested)
| 3 µl insert | |
| 3 µl vector | |
| 1 µl 10X ligation buffer | 37°C incubation for 30 min |
| 3 µl H2O | |
| 10 µl final vol. |
4. Transformation
3 µl annealing reaction is added to 50 µl electro-competent BW23474 cells, electroporated, then 300 µl SOC added, shaken at 37°C for 30-45 min and then everything plated.
Material you can get from our facility (EMBL internal users only)
- Vectors for PCR or linearised vector DNA ready for T4 DNA polymerase treatment
- T4 DNA polymerase + buffer
- Primers LP1, LP2, LPsumo
- Pfu DNA polymerase
- E. coli BW23474 cells
- His-3C protease
- His-SenP2 (SUMO protease)
References
Li M.Z. & Elledge S.J. (2007), “Harnessing homologous recombination in vitro to generate recombinant DNA via SLIC”, Nature Methods, 2007, 4 (3), 251-256
Doyle S.A. (2005), “High-throughput cloning for proteomics research”, Methods Mol. Biol., 310, 107-113
